Commit d9bea267 authored by Andreas Klebinger's avatar Andreas Klebinger

fasta: Make rnd function in fasta-c static.

This avoid the warning by default and allows it to build with -O0.
Without it we get linker errors at -O0. I do not know why.
parent 860d45e0
......@@ -78,7 +78,7 @@ static char *alu =
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
inline unsigned int rnd(void) {
static inline unsigned int rnd(void) {
static unsigned rseed = 42;
return rseed = (rseed * RA + RC) % RMAX;
}
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment